Contents

3. Control flow

3.1. Introduction to control flow

The if statement is used to check a condition: if the condition is true, we run a block of statements (called the if-block), next we can test another condition (elif, short for “else if”) and we process another block of statements (called the elif-block). Lastly, we can use an else clause, which is optional.

cell_lines = ['HCT116', 'HeLa', 'HEK293']
c = 'HeLa'

if c in cell_lines:
    # New block starts here
    print('Yes, cell line is present.')
    # New block ends here
elif c not in cell_lines:
    # Another block
    print('No, not present')
    # block ends here

Yes, cell line is present.

Now, run the same commands for c = 'U2Os'.

Note the following:

  • In the example above we used if c in cell_lines to test a condition (“is c an element of the list cell_lines?”).

  • The checked condition statement is always followed by :.

  • The following block is indented, 4 spaces is conventionally used.

  • The outcome of such test is True or False. If True, the codeblock is executed

  • Here are some operators for condition tests:

    • in is an element of

    • == equivalence (values, strings)

    • > greater than

    • >= greater than or equal

    • < less than

    • <= less than or equal

    • != not equal

  • You can combine condition tests with or, and

  • You can “invert” a condition by placing not in front

  • = is different from == !!

Here is another example, in this case we use if to compare values:

some_number = 10
n = 9
 
if n < some_number:
    print('Your number n is less.')
elif n == some_number:
    print('Your number n is exactly the same!')
else:
    print('No idea...greater maybe?')

Your number n is less.

Run the same block for other values of n.

The result of your condition test is True or False. Check this by running:

c in cell_lines

n < some_number

So, simply running the following also works:

if True:
    print('Yes, no doubt about this...')

Yes, no doubt about this...

One conditional can also be nested within another. For example:

x = 5
y = 6

if x == y:
    print('x and y are equal')
else:
    if x < y:
        print('x is less than y')
    else:
        print('x is greater than y')

x is less than y

Although the indentation of the statements makes the structure apparent, nested conditionals become difficult to read very quickly. Logical operators (e.g. and, or) often provide a way to simplify nested conditional statements. For example, we can rewrite the following code using a single conditional:

x = 1

if 0 < x:
    if x < 10:
        print('x is a positive single-digit number.')

x is a positive single-digit number.

The print() statement is executed only if we make it past both conditionals, so we can get the same effect with the and operator:

if 0 < x and x < 10:
    print('x is a positive single-digit number.')

x is a positive single-digit number.

3.2. Glossary of control flow terms

  • if

  • elif

  • else

  • and

  • or

  • not

  • in

  • ==

  • >

  • >=

  • <

  • <=

  • !=

3.3. Exercises: control flow

Exercise 3.1

Here are two variables containing sequences:

a = 'GCTAGGCAGGTGCAGGGGTAG'
b = 'GGCAGATAGGACAGTGAGGGACATAGACCATAGACGANCATGACTTAG'

Write a block of statements that provides an answer to the question whether:

  • the sequence of a is the same as the sequence of b

  • a is longer than b, shorter than b, or the same length as b

  • which of the sequences (if any) contains an 'N'

Exercise 3.2

Take the following DNA sequence.

dna = "TTGCATGTCAATCGATCGGATTGGTTGATTTATCCCGA"

Write code that will print * if there is a stop codon in this sequence (TAA, TAG or TGA).

Exercise 3.3

Read the description and methods of the UCSC CpG island track: https://genome.ucsc.edu/cgi-bin/hgTrackUi?g=cpgIslandSuper.

Write the code that will test if a sequence is a CpG island. You can test your code with the following sequences (only the first is a CpG island):

#chr15:74022901-74023101
seq1 = ("AAGTGCGACATCAGCGCAGAGATCCAGCAGCGACAGGAGGAG"
        "CTGGACGCCATGACGCAGGCGCTGCAGGAGCAGGATAGTGCC"
        "TTTGGCGCGGTTCACGCGCAGATGCACGCGGCCGTCGGCCAG"
        "CTGGGCCGCGCGCGTGCCGAGACCGAGGAGCTGATCCGCGAG"
        "CGCGTGCGCCAGGTGGTAGCTCACGTGCGGGCGT")

#chr15:74022838-74023029
seq2 = ("CGAGGATGTTCCAAGCCGCTGTGCTGCTCGTGCGCGCTCCTT"
        "GACAGCAGCCACAGTGAGCTCAAGTGCGACATCAGCGCAGAG"
        "ATCCAGCAGCGACAGGAGGAGCTGGACGCCATGACGCAGGCG"
        "CTGCAGGAGCAGGATAGTGCCTTTGGCGCGGTTCACGCGCAG"
        "ATGCACGCGGCCGTCGGCCAGCTG")

#chr15:74022489-74022698 
seq3 = ("AGATGTGTGGAAGGGTGCACCCCACGATGCTCACCTGGTGCT"
        "TCCTCGGTGGGGAAGGGAAATTCAGAAGTGGTGGAAAGAGAT"
        "GATTGTCGTTTCGTATATCTTTGTATTGTTTCCCGGATGTTG"
        "AAATTGTTACTGTAGTAACTTTTTATACTCATGTGTTATTGG"
        "TAGTTTGGATACTATCACCATAACCACAAACACTGAATTAGG")