3. Control flow¶
3.1. Introduction to control flow¶
The if statement is used to check a condition: if the condition is true, we run a block of statements (called the if-block), next we can test another condition (elif, short for “else if”) and we process another block of statements (called the elif-block). Lastly, we can use an else clause, which is optional.
cell_lines = ['HCT116', 'HeLa', 'HEK293']
c = 'HeLa'
if c in cell_lines:
# New block starts here
print('Yes, cell line is present.')
# New block ends here
elif c not in cell_lines:
# Another block
print('No, not present')
# block ends here
Yes, cell line is present.
Now, run the same commands for c = 'U2Os'.
Note the following:
In the example above we used
if c in cell_linesto test a condition (“is c an element of thelistcell_lines?”).The checked condition statement is always followed by
:.The following block is indented, 4 spaces is conventionally used.
The outcome of such test is
TrueorFalse. IfTrue, the codeblock is executedHere are some operators for condition tests:
inis an element of==equivalence (values, strings)>greater than>=greater than or equal<less than<=less than or equal!=not equal
You can combine condition tests with
or,andYou can “invert” a condition by placing
notin front=is different from==!!
Here is another example, in this case we use if to compare values:
some_number = 10
n = 9
if n < some_number:
print('Your number n is less.')
elif n == some_number:
print('Your number n is exactly the same!')
else:
print('No idea...greater maybe?')
Your number n is less.
Run the same block for other values of n.
The result of your condition test is True or False. Check this by running:
c in cell_lines
n < some_number
So, simply running the following also works:
if True:
print('Yes, no doubt about this...')
Yes, no doubt about this...
One conditional can also be nested within another. For example:
x = 5
y = 6
if x == y:
print('x and y are equal')
else:
if x < y:
print('x is less than y')
else:
print('x is greater than y')
x is less than y
Although the indentation of the statements makes the structure apparent, nested conditionals become difficult to read very quickly.
Logical operators (e.g. and, or) often provide a way to simplify nested conditional statements. For example, we can rewrite the following code using a single conditional:
x = 1
if 0 < x:
if x < 10:
print('x is a positive single-digit number.')
x is a positive single-digit number.
The print() statement is executed only if we make it past both conditionals, so we can get the same effect with the and operator:
if 0 < x and x < 10:
print('x is a positive single-digit number.')
x is a positive single-digit number.
3.2. Glossary of control flow terms¶
ifelifelseandornotin==>>=<<=!=
3.3. Exercises: control flow¶
Exercise 3.1
Here are two variables containing sequences:
a = 'GCTAGGCAGGTGCAGGGGTAG'
b = 'GGCAGATAGGACAGTGAGGGACATAGACCATAGACGANCATGACTTAG'
Write a block of statements that provides an answer to the question whether:
the sequence of
ais the same as the sequence ofbais longer thanb, shorter thanb, or the same length asbwhich of the sequences (if any) contains an
'N'
Exercise 3.2
Take the following DNA sequence.
dna = "TTGCATGTCAATCGATCGGATTGGTTGATTTATCCCGA"
Write code that will print * if there is a stop codon in this sequence (TAA, TAG or TGA).
Exercise 3.3
Read the description and methods of the UCSC CpG island track: https://genome.ucsc.edu/cgi-bin/hgTrackUi?g=cpgIslandSuper.
Write the code that will test if a sequence is a CpG island. You can test your code with the following sequences (only the first is a CpG island):
#chr15:74022901-74023101
seq1 = ("AAGTGCGACATCAGCGCAGAGATCCAGCAGCGACAGGAGGAG"
"CTGGACGCCATGACGCAGGCGCTGCAGGAGCAGGATAGTGCC"
"TTTGGCGCGGTTCACGCGCAGATGCACGCGGCCGTCGGCCAG"
"CTGGGCCGCGCGCGTGCCGAGACCGAGGAGCTGATCCGCGAG"
"CGCGTGCGCCAGGTGGTAGCTCACGTGCGGGCGT")
#chr15:74022838-74023029
seq2 = ("CGAGGATGTTCCAAGCCGCTGTGCTGCTCGTGCGCGCTCCTT"
"GACAGCAGCCACAGTGAGCTCAAGTGCGACATCAGCGCAGAG"
"ATCCAGCAGCGACAGGAGGAGCTGGACGCCATGACGCAGGCG"
"CTGCAGGAGCAGGATAGTGCCTTTGGCGCGGTTCACGCGCAG"
"ATGCACGCGGCCGTCGGCCAGCTG")
#chr15:74022489-74022698
seq3 = ("AGATGTGTGGAAGGGTGCACCCCACGATGCTCACCTGGTGCT"
"TCCTCGGTGGGGAAGGGAAATTCAGAAGTGGTGGAAAGAGAT"
"GATTGTCGTTTCGTATATCTTTGTATTGTTTCCCGGATGTTG"
"AAATTGTTACTGTAGTAACTTTTTATACTCATGTGTTATTGG"
"TAGTTTGGATACTATCACCATAACCACAAACACTGAATTAGG")