Contents

1. First exercises

1.1. Exercises: integer (int) and string (str) variables

Exercise 1.1

Consider the following code:

a = 10
b = 4
c = a + b
print(c)

  1. Question: What is the value of c that is printed?

  2. Modify the value that is assigned to variable b in such a way that the value of c printed to screen is 16.

Exercise 1.2

Create two variables a and b, and assign them the values 4 and 20 respectively. Create a new variable c that is the sum of these two variables. Your code should produce the following output by printing the value of the variable c to the screen:

a + b = 24

Exercise 1.3

Run the following code:

a = 10
b = 4
c = a + b
print(c)
print(c)

  1. Question: Which value is printed to the screen and how often?

Now assign the variable b a new value after having printed the value of c, like so:

a = 10
b = 4
c = a + b
print('a + b = ',c)
b = 10
print('a + b = ',c)

  1. Question: Why does the value of the variable c not change between the first and the second print statement (in line 4 and line 6 respectively)?

Exercise 1.4

Run the following code (make sure to write it exactly as shown here):

a = '10'
b = '4'
c = a + b
print(c)

  1. Question: what is printed to the screen?

  2. Question: what type of variable are a, b and c? (e.g. list, integer, float, string)

  3. Question: why does it not print 14 to the screen? You could also try this example to see what is happening:

a = '10'
b = '4'
c = a + '+' + b
print(c)

Exercise 1.5

Have a look at the following code (do not run it yet):

a = 10
b = '4'
c = a + b
print(c)

  1. Question: what type of variable is a?

  2. Question: what type of variable is b?

  3. Question: what is the output of the code? (Run it!)

  4. Question: do you understand the output?

1.2. Working with strings

As you have seen, you can combine strings using the + operator.

first_part = "this is "
second_part = "a long string"

print(first_part + second_part)

this is a long string

If you want to access specific parts of a string you can use [ and ] with a number in between.

msg = "hello there!"
msg[1]

'e'

You’ll see that [1] selects the second character of the string "hello there!". Why the second and not the first? This is because Python, like many other programming language, starts counting at 0.

There is a more extended version, where you create a slice. In this case you specify [start:end]. This looks as follows:

msg[0:5]

'hello'

Here you see that you can take a substring of string. In other words, you select a smaller part of a string.

You can convert a number, such as an int or float to a string with the str() method.

a = 0.12
print(type(a))
b = str(a)
print(type(b))

<class 'float'>
<class 'str'>

Similarly, you can convert a string that contains a number to an integer with the int() function or to a float with the float() function.

Strings have a number of methods that allow you to perform a variety of useful functions. For instance, lower() creates a new string where all characters are in lowercase.

s1 = "ATG"
s2 = s1.lower()
print(s2)

atg

Similarly, you can use upper() to convert a string to all uppercase. These methods create a new string, they leave the string you use to call the method unchanged.

Here is a list of useful string methods. For a complete overview you can check the Python string documentation.

  • upper() - Returns a string in uppercase

  • lower() - Returns a string in lowercase

  • len() - Returns the length of a string

  • count() - Returns the number of occurrences of a string within another string

  • replace() - Returns a string with specific text replaced

  • find() - Return the first position where a substring is found, or -1 if is not found

  • strip() - Returns a string with all leading and trailing whitespace removed

1.3. Exercises: strings

Exercise 1.6

You are going to analyze the following sequence in more detail using Python:

GCTTGACAGGTAGACAGGACCCATAGACAGGATAGACAGGTAGACAGGGATAGACAGGGATAGCCAGATAGACGATAGCGATGATAC

To get this sequence into python you are allowed to copy paste! Provide answers + code to the following questions:

  1. What is the length of this sequence?

  2. What is the 40th base of this sequence?

  3. Is there a C in the sequence starting at base position 44 and ending at position 53? (let Python tell you)

Exercise 1.7

Given the following input:

seq1 = "ATG"
seq2 = "GATTACA"
seq3 = "A"

Write the code that will calculate the total length of these three sequences and print the following output:

Total length: 11

Exercise 1.8

An open reading frame is a sequence of DNA that starts with the start codon ATG and ends with a stop codon (TAA, TAG or TGA). Take the following DNA sequence.

dna = "TTGCATGTCAATCGATCGGATTGGTTGATTTATCCCGA"

This sequence contains one ORF, with a start codon at the 5th position and a stop codon (TGA) at the 26th position.

  1. Write code that will print the ORF of this sequence.

Let’s look at a different DNA sequence:

dna2 = "CCGGTATGCGGTTCTGACCA"

  1. Does the code that you wrote for 1) also work for this sequence? If not, write code that will print the ORF of a DNA sequence (only with the TGA stop codon) that works with either of this sequences.

Exercise 1.9

Write code that will print the GC content of a sequence. This is the fraction of a sequence that is either C or G. When you use string dna from 1.8 it should print the following:

GC content: 42%

Exercise 1.10

Write code that will print a sequence in lower-case with the ORF (start ATG, stop TGA) in upper-case.

For instance, the following sequence:

dna = "TTGCATGTCAATCGATCGGATTGGTTGATTTATCCCGA"

Would be printed like this:

ttgcATGTCAATCGATCGGATTGGTTGAtttatcccga